Dcp2 FL-H1
(Plasmid #163583)

• Purpose: express Dcp2 FL-H1 at endogenous level in S.cerevisiae
• Depositing Lab: Michael Rosen
• Publication: Xing et al Elife. 2020 Jun 19;9. pii: 56525. doi: 10.7554/eLife.56525.

Backbone

• Vector backbone: pRP1903
• Backbone size w/o insert (bp): 5827
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Dcp2
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 3504
• Mutation: The first HLM (EDQLKSYAEEQLKLLLGITKEE) is added to the C-terminal end of Dcp2 FL
• Entrez Gene: DCP2 (a.k.a. YNL118C, PSU1)
• Promoter: DCP2 promoter
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: See comments
• 3′ sequencing primer: Dcp2-seq3: CCACATTGATAAGGGTCTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Roy Parker's lab at University of Colorado, Boulder

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Added HLM1 to the C-terminal end of Dcp2 FL.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG