Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV_hSynapsin_psychLight2
(Plasmid #163909)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163909 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV9 163909-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $405

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4579
  • Total vector size (bp) 6691
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    psychLight2
  • Species
    Synthetic
  • Insert Size (bp)
    2112
  • GenBank ID
    2403243
  • Promoter Synapsin
  • Tag / Fusion Protein
    • Flag tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer atgaagacgatcatcgccctgagc
  • 3′ sequencing primer ttacacctcgttctcgtagcagaatac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for AAV9 (Catalog # 163909-AAV9) ( Back to top )

Purpose

Ready-to-use AAV9 particles produced from pAAV_hSynapsin_psychLight2 (#163909). In addition to the viral particles, you will also receive purified pAAV_hSynapsin_psychLight2 plasmid DNA.

Synapsin-driven expression of the genetically encoded fluorescent sensor psychLight2 to detect behaviorally relevant serotonin release. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_hSynapsin_psychLight2 was a gift from Lin Tian (Addgene plasmid # 163909 ; http://n2t.net/addgene:163909 ; RRID:Addgene_163909)

    For viral preps, please replace (Addgene plasmid # 163909) in the above sentence with: (Addgene viral prep # 163909-AAV9)

  • For your References section:

    Psychedelic-inspired drug discovery using an engineered biosensor. Dong C, Ly C, Dunlap LE, Vargas MV, Sun J, Hwang IW, Azinfar A, Oh WC, Wetsel WC, Olson DE, Tian L. Cell. 2021 Apr 8. pii: S0092-8674(21)00374-3. doi: 10.1016/j.cell.2021.03.043. 10.1016/j.cell.2021.03.043 PubMed 33915107