Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

EF1a_DIO_mMeCP2-HaloTag
(Plasmid #164062)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164062 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-EF1a
  • Total vector size (bp) 8063
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MeCP2 Isoform 1
  • Alt name
    Mecp2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2400
  • Entrez Gene
    Mecp2 (a.k.a. 1500041B07Rik, D630021H01Rik, Mbd5, WBP10)
  • Promoter EF1a
  • Tag / Fusion Protein
    • HaloTag (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTGGATTGTAGCTGCTATTAGCAATATGA
  • 3′ sequencing primer TATACGAAGTTATTCTTTGCACCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EF1a_DIO_mMeCP2-HaloTag was a gift from Nathaniel Heintz (Addgene plasmid # 164062 ; http://n2t.net/addgene:164062 ; RRID:Addgene_164062)
  • For your References section:

    MeCP2 nuclear dynamics in live neurons results from low and high affinity chromatin interactions. Piccolo FM, Liu Z, Dong P, Hsu CL, Stoyanova EI, Rao A, Tjian R, Heintz N. Elife. 2019 Dec 23;8. pii: 51449. doi: 10.7554/eLife.51449. 10.7554/eLife.51449 PubMed 31868585