Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pInducer10b-EGFP-KRAS G12V
(Plasmid #164925)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164925 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pInducer-10b
  • Backbone size w/o insert (bp) 12176
  • Total vector size (bp) 13460
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Enhanced green fluorescent protein
  • Alt name
    EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Promoter Ubc promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site Not I (unknown if destroyed)
  • 5′ sequencing primer ACCATGGTGAGCAAGGGCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    KRAS proto-oncogene, GTPase (KRAS) G12V mutant
  • Alt name
    KRAS G12V
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    567
  • Mutation
    Glycine 12 changed to valine (G->T 3156)
  • GenBank ID
    NM_004985.5
  • Entrez Gene
    KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
  • Promoter Ubc Promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site Mlu I (unknown if destroyed)
  • 5′ sequencing primer ATGACTGAATATAAACTTGT
  • 3′ sequencing primer CGAGAAGCGCGATCACATGGTCCTGCTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pInducer10b-EGFP-KRAS G12V was a gift from Ji Luo (Addgene plasmid # 164925 ; http://n2t.net/addgene:164925 ; RRID:Addgene_164925)
  • For your References section:

    A high-throughput assay for small molecule destabilizers of the KRAS oncoprotein. Carver J, Dexheimer TS, Hsu D, Weng MT, Smith JL, Guha R, Jadhav A, Simeonov A, Luo J. PLoS One. 2014 Aug 5;9(8):e103836. doi: 10.1371/journal.pone.0103836. eCollection 2014. 10.1371/journal.pone.0103836 PubMed 25093678