-
PurposeBacterial expression of M-MLV reverse transcriptase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-28a(+)
-
Backbone manufacturerNovagen (EMD Millipore)
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 7306
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsRosetta (DE3) strain for protein expression
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegag-pol
-
Alt nameM-MLV Reverse Transcriptase
-
Alt namePr180
-
SpeciesMoloney murine leukemia virus
-
Insert Size (bp)2100
-
MutationD524N, H8Y
-
GenBank ID2193424 AAC82568
- Promoter T7
-
Tags
/ Fusion Proteins
- 6X His (N terminal on backbone)
- 6X His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was found in our lab stocks. Its original source in not known.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-28a_6H-MMLV_RT_D524N-6H was a gift from Robert Tjian (Addgene plasmid # 166945 ; http://n2t.net/addgene:166945 ; RRID:Addgene_166945) -
For your References section:
Open-source RNA extraction and RT-qPCR methods for SARS-CoV-2 detection. Graham TGW, Dugast-Darzacq C, Dailey GM, Nguyenla XH, Van Dis E, Esbin MN, Abidi A, Stanley SA, Darzacq X, Tjian R. PLoS One. 2021 Feb 3;16(2):e0246647. doi: 10.1371/journal.pone.0246647. eCollection 2021. 10.1371/journal.pone.0246647 PubMed 33534838