Skip to main content

6xHis-TEV-ATG3 (Human autophagy E2-like enzyme)
(Plasmid #169079)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 169079 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pETDuet1
  • Backbone manufacturer
    Merck
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 6352
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ATG3
  • Alt name
    APG3; APG3L; PC3-96; APG3-LIKE
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    945
  • GenBank ID
    64422 NC_000003.12
  • Entrez Gene
    ATG3 (a.k.a. APG3, APG3-LIKE, APG3L, PC3-96, hApg3)
  • Promoter T7 lac promoter
  • Tag / Fusion Protein
    • 6X Histidine Tag, TEV cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site Notl (not destroyed)
  • 5′ sequencing primer ATGCGTCCGGCGTAGA
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Internal construct reference: SMC-861

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    6xHis-TEV-ATG3 (Human autophagy E2-like enzyme) was a gift from Sascha Martens (Addgene plasmid # 169079 ; http://n2t.net/addgene:169079 ; RRID:Addgene_169079)
  • For your References section:

    A PI3K-WIPI2 positive feedback loop allosterically activates LC3 lipidation in autophagy. Fracchiolla D, Chang C, Hurley JH, Martens S. J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098. 10.1083/jcb.201912098 PubMed 32437499