-
Purpose(Empty Backbone) Cas9-2A-GFP expression vector bearing two (one additional) independent sgRNA cassettes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172221 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (Plasmid #48138)
-
Backbone manufacturerFeng Zhang
- Backbone size (bp) 9288
-
Modifications to backboneA second sgRNA cloning cassette (SapI clonable sgRNA) was inserted into the KpnI site (restored).
-
Vector typeMammalian Expression, CRISPR
- Promoter Cbh
-
Tags
/ Fusion Proteins
- 3XFLAG (N terminal on insert)
- GFP (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 3′ sequencing primer ggaaagtccctattggcgtta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe inserted SapI sgRNA cassette was ordered as a dsDNA gBlock from IDT.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2X_pX458_pSpCas9(BB)-2A-GFP was a gift from Alexander Meissner (Addgene plasmid # 172221 ; http://n2t.net/addgene:172221 ; RRID:Addgene_172221) -
For your References section:
Topological isolation of developmental regulators in mammalian genomes. Wu HJ, Landshammer A, Stamenova EK, Bolondi A, Kretzmer H, Meissner A, Michor F. Nat Commun. 2021 Aug 12;12(1):4897. doi: 10.1038/s41467-021-24951-7. 10.1038/s41467-021-24951-7 PubMed 34385432