1
Plasmid 17264: pCGLex
  • None

  • LexA

  • N terminal on backbone

  • pPC86
    (Search Vector Database)

  • Yeast Expression

  • 6160

  • EcoRI

  • No

  • SacII

  • No

  • CGTCAGCAGAGCTTCACCATTG List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • TRP1

  • View sequences (1)
  • View map

  • Stuart Schreiber

  • MTA

Comments: 

ref for pPC86: Chevray, P. M. & Nathans, D. (1992) Proc. Natl. Acad. Sci. USA 89, 5789-5793; ref for pEG202: Golemis, E. A., Gyuris, J. & Brent, R. (1996) in Current Protocols in Molecular Biology, eds. Ausubel, F. M., Brent, R., Kingston, R., Moore, D., Seidman, J., Smith, J. A. & Struhl, K. (Wiley, New York), p. 20.1.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A yeast genetic system for selecting small molecule inhibitors of protein-protein interactions in nanodroplets. Huang et al (Proc Natl Acad Sci U S A. 1997 Dec 9. 94(25):13396-401. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 17264" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with