Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pENTR/pTER shEGFP #1 (628-2)
(Plasmid #17470)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 17470 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pENTR1A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2555
  • Vector type
    RNAi ; Entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    TOP10F', 37oC
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Enhanced green fluorescent protein shRNA #1
  • Alt name
    GFP shRNA #1
  • Insert Size (bp)
    65

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (destroyed during cloning)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer ENTRforw
  • 3′ sequencing primer ENTRrev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

shRNA oligo sequence 5'-CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR/pTER shEGFP #1 (628-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17470 ; http://n2t.net/addgene:17470 ; RRID:Addgene_17470)
  • For your References section:

    A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD.. PLoS One. 2009 Aug 6;4(8):e6529. 10.1371/journal.pone.0006529 PubMed 19657394