Plasmid 17575: pBPGUw

• Gene/insert name: GAL4
• Insert size: 2646
• Species: S. cerevisiae (budding yeast)
• Entrez Gene: GAL4 (YPL248C, GAL81)
  
• Vector backbone: pBDP
  (Search Vector Database)
• Vector type: Insect Expression
• Backbone size w/o insert (bp): 9052
• Cloning site 5': KpnI
• Site destroyed during cloning: No
• Cloning site 3': NotI
• Site destroyed during cloning: No
• 5' sequencing primer: BDP F (bp 11,652): AAATAGGGGTTCCGCGCACAT
• 3' sequencing primer: BDP R (bp 5,435) : ATAATGGTGCAGGGCGCTGAC
• Bacterial resistance(s) Ampicillin and Chloramphenicol
• Growth strain(s) DB3.1
• Growth temperature (℃): 37
• Growth instructions: Bacterial Strain DB3.1 (Invitrogen) or similar must be used to propagate plasmids carrying the ccdB gene.
• High or low copy: High Copy
• Person or lab that originally
  cloned the gene/insert: GAL4 leader, CDS, and hsp70 polyA were cloned from pGaTB (via DGRC).
• Sequence: View sequences (3)
• Map: View map
• Map: View map
• Principal Investigator: Gerald Rubin
• Terms and Licenses: MTA

Comments: 

pBPGUw is a modular Gateway compatible GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. pBPGUw contains a Drosophila synthetic core promoter (DSCP) that contains TATA, Inr, MTE, and DPE motifs. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.

Article: Tools for Neuroanatomy and Neurogenetics in Drosophila Pfeiffer et al (Tools for neuroanatomy and neurogenetics in Drosophila PubMed)