Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TetO-FUW-mWnt1
(Plasmid #176486)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176486 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    TetO-FUW
  • Backbone size w/o insert (bp) 8393
  • Total vector size (bp) 9511
  • Vector type
    Lentiviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    The Wernig lab uses JM109 for downstream applications.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mouse Wnt1 cDNA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1113
  • Entrez Gene
    Wnt1 (a.k.a. Int-1, Wnt-1, sw, swaying)
  • Promoter TetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TGACCTCCATAGAAGACACC
  • 3′ sequencing primer TTTTGTAATCCAGAGGTTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TetO-FUW-mWnt1 was a gift from Marius Wernig (Addgene plasmid # 176486 ; http://n2t.net/addgene:176486 ; RRID:Addgene_176486)
  • For your References section:

    Efficient generation of dopaminergic induced neuronal cells with midbrain characteristics. Ng YH, Chanda S, Janas JA, Yang N, Kokubu Y, Sudhof TC, Wernig M. Stem Cell Reports. 2021 Jul 13;16(7):1763-1776. doi: 10.1016/j.stemcr.2021.05.017. Epub 2021 Jun 24. 10.1016/j.stemcr.2021.05.017 PubMed 34171286