Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pT7C-HSPH1
(Plasmid #177662)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177662 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT7C
  • Backbone size w/o insert (bp) 3352
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    To produce protein, express in BL21(DE3) Codon Plus RIL. Purify by Ni IMAC and SEC.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HSPH1
  • Alt name
    NP_006635.2
  • Alt name
    HSPH1 Isoform 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2577
  • Entrez Gene
    HSPH1 (a.k.a. HSP105, HSP105A, HSP105B, NY-CO-25)
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-Thrombin (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GATTATCAACCGGGGTGGCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Genes were cloned from a cDNA library and may contain silent mutations. However, all inserts were sequence-verified and any nucleotide changes were mutagenized to encode the consensus amino acid sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7C-HSPH1 was a gift from Jeff Kuret (Addgene plasmid # 177662 ; http://n2t.net/addgene:177662 ; RRID:Addgene_177662)
  • For your References section:

    Identification of gene networks mediating regional resistance to tauopathy in late-onset Alzheimer's disease. Ayoub CA, Wagner CS, Kuret J. PLoS Genet. 2023 Mar 27;19(3):e1010681. doi: 10.1371/journal.pgen.1010681. eCollection 2023 Mar. 10.1371/journal.pgen.1010681 PubMed 36972319