MDH1-shSHP2-3-H2Kb2
(Plasmid #17854)

• Depositing Lab: Chang-Zheng Chen
• Publication: Li et al Cell. 2007 Apr 6. 129(1):147-61.

Backbone

• Vector backbone: MDH1-404-H2Kb2
• Backbone manufacturer: Chen lab
• Backbone size w/o insert (bp): 8200
• Vector type: Mammalian Expression, Retroviral, RNAi
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: shSHP2
• Alt name: SHP2
• Species: H. sapiens (human)
• Entrez Gene: PTPN11 (a.k.a. BPTP3, CFC, JMML, METCDS, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: See map (not destroyed)
• 3′ cloning site: See map (not destroyed)
• 5′ sequencing primer: H1

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Target region of SHP-2: TTGCCCACGCATATCATGTAGT (NM_011202.3: 5421 to 5442, 3’ UTR).