pOUPc-UL148-HA
(Plasmid
#179343)
-
PurposeAll-in-one "tet-on" 3G lentiviral vector plasmid encoding human cytomegalovirus UL148 ER resident glycoprotein with a C-terminal HA tag fused to its cytoplasmic tail
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepOUPc
-
Backbone manufacturerSteve Elledge
- Backbone size w/o insert (bp) 12095
- Total vector size (bp) 13070
-
Modifications to backboneinsertion of UL148-HA by AgeI-MluI. Note: pOUPc is an extensively modified version of pInducer20 (Elledge lab shRNA vector) that is used to express proteins. The CMV IE2 binding site (crs) in the TRE 3G promoter is also mutated so that it would not be repressed by IE2 during CMV infection.
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology ; HIV-1 based replication defective lentivirus vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman cytomegalovirus UL148 fused to HA epitope
-
Alt nameUL148
-
SpeciesHuman betaherpesvirus 5 (human cytomegalovirus)
-
Insert Size (bp)975
-
Mutationinsert matches UL148 from strain TB40/E
-
GenBank IDEF999921.1
- Promoter Tet responsive element 3G
-
Tag
/ Fusion Protein
- HA tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TCAGGTAGTGAACCGTCAG
- 3′ sequencing primer TGATACTGGGGTTCTAAGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The pOUPc backbone was generated by making extensive modifications to pInducer20 (Addgene Plasmid #44012)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOUPc-UL148-HA was a gift from Jeremy Kamil (Addgene plasmid # 179343 ; http://n2t.net/addgene:179343 ; RRID:Addgene_179343) -
For your References section:
The Human Cytomegalovirus Endoplasmic Reticulum-Resident Glycoprotein UL148 Activates the Unfolded Protein Response. Siddiquey MNA, Zhang H, Nguyen CC, Domma AJ, Kamil JP. J Virol. 2018 Sep 26;92(20). pii: JVI.00896-18. doi: 10.1128/JVI.00896-18. Print 2018 Oct 15. 10.1128/JVI.00896-18 PubMed 30045994