pOUPc-UL148-HA
(Plasmid #179343)

• Purpose: All-in-one "tet-on" 3G lentiviral vector plasmid encoding human cytomegalovirus UL148 ER resident glycoprotein with a C-terminal HA tag fused to its cytoplasmic tail
• Depositing Lab: Jeremy Kamil
• Publication: Siddiquey et al J Virol. 2018 Sep 26;92(20). pii: JVI.00896-18. doi: 10.1128/JVI.00896-18. Print 2018 Oct 15.

Backbone

• Vector backbone: pOUPc
• Backbone manufacturer: Steve Elledge
• Backbone size w/o insert (bp): 12095
• Total vector size (bp): 13070
• Modifications to backbone: insertion of UL148-HA by AgeI-MluI. Note: pOUPc is an extensively modified version of pInducer20 (Elledge lab shRNA vector) that is used to express proteins. The CMV IE2 binding site (crs) in the TRE 3G promoter is also mutated so that it would not be repressed by IE2 during CMV infection.
• Vector type: Mammalian Expression, Lentiviral, Synthetic Biology ; HIV-1 based replication defective lentivirus vector
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human cytomegalovirus UL148 fused to HA epitope
• Alt name: UL148
• Species: Human betaherpesvirus 5 (human cytomegalovirus)
• Insert Size (bp): 975
• Mutation: insert matches UL148 from strain TB40/E
• GenBank ID: EF999921.1
• Promoter: Tet responsive element 3G
• Tag / Fusion Protein:
  • HA tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: TCAGGTAGTGAACCGTCAG
• 3′ sequencing primer: TGATACTGGGGTTCTAAGGC

Resource Information

• Supplemental Documents:
  • pOUPc UL148HA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The pOUPc backbone was generated by making extensive modifications to pInducer20 (Addgene Plasmid #44012)