PB-TO-ASCL1-DLX2
(Plasmid #182307)

• Purpose: Piggybac Tet-ON plasmid for differentiating hiPSCs into GABAergic neuron via ASCL1 and DLX2 expression
• Depositing Labs: iPSC Neurodegenerative Disease Initiative (iNDI), Michael Ward
• Publication: Characterization of iPSC lines for the iPSC Neurodegenerative Disease Initiative (iNDI) (unpublished)

Backbone

• Vector backbone: pUCM
• Backbone size w/o insert (bp): 12978
• Total vector size (bp): 15250
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Ascl1
• Alt name: ASH1
• Species: M. musculus (mouse)
• Insert Size (bp): 695
• Entrez Gene: Ascl1 (a.k.a. ASH1, Mash1, bHLHa46)
• Promoter: pTRE3G-bidirectional
• Tag / Fusion Protein:
  • None

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: KflI (unknown if destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: caagttggggtgggcgat

Gene/Insert 2

• Gene/Insert name: Dlx2
• Species: M. musculus (mouse)
• Insert Size (bp): 997
• Entrez Gene: Dlx2 (a.k.a. DII A, Dlx-2, Tes-1)
• Promoter: pTRE3G-bidirectional
• Tag / Fusion Protein:
  • None

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: tcactgatagggagtaaagtctg

Gene/Insert 3

• Gene/Insert name: puroR-T2A-mycNLS-mTagBFP2
• Insert Size (bp): 1473
• Promoter: EF1a
• Tag / Fusion Protein:
  • T2A-mycNLS-mTagBFP2

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: SwaI (not destroyed)
• 3′ cloning site: N/A (unknown if destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• Supplemental Documents:
  • K6-PB-TO-ASCL1-DLX2.gbk
• A portion of this plasmid was derived from a plasmid made by: Michael Ward lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry