pUG36-NES-EGFP-cPHx3
(Plasmid #183668)

• Purpose: PtdIns(3,4)P2 biosensor for expression in yeast
• Depositing Lab: Sergio Grinstein
• Publication: Walpole et al Nat Cell Biol. 2022 Apr 28. pii: 10.1038/s41556-022-00895-y. doi: 10.1038/s41556-022-00895-y.

Backbone

• Vector backbone: pUG36
• Backbone manufacturer: Gueldener U, Hegemann JH.
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PLEKHA1
• Alt name: TAPP1
• Species: H. sapiens (human), X. laevis (frog)
• Mutation: Amino acids 169-329 (tandem trimer)
• Entrez Gene: PLEKHA1 (a.k.a. TAPP1)
• Promoter: MET25
• Tag / Fusion Protein:
  • X. laevis map2k1.L(32-44)-EGFP (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aggtggcaccttgtccaattgaac
• 3′ sequencing primer: ataaatagggacctagacttcagg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Insert from Addgene Plasmid #116855

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry