huntingtin:TOC031-A07:C246751
(Plasmid
#183984)
-
PurposeBaculovirus expression for structure determination. May not contain entire coding region of gene.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183984 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBacMam2-DiEx-LIC-C-flag
-
Backbone manufacturerPlasmid #111752
-
Vector typeBaculovirus Expresssion
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHTT
-
Alt nameHTT_V2095-V3138
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3132
-
Entrez GeneHTT (a.k.a. HD, IT15, LOMARS)
- Promoter CMV and P10
-
Tag
/ Fusion Protein
- Flag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pFBM-F:caaaatgtcgtaacaactccgc
- 3′ sequencing primer pFBM-R: tagttaagaataccagtcaatctttcac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SGC Clone Sample ID: huntingtin:TOC031-A07:C246751.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
huntingtin:TOC031-A07:C246751 was a gift from Cheryl Arrowsmith (Addgene plasmid # 183984 ; http://n2t.net/addgene:183984 ; RRID:Addgene_183984)