pRS416 Gal-RNQ1
(Plasmid
#18684)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 18684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS416 Gal
- Backbone size w/o insert (bp) 5574
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRnq1
-
Alt nameGal-Rnq1 p416
-
Alt nameGal Rnq1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1218
-
Entrez GeneRNQ1 (a.k.a. YCL028W)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer From Gal Promoter GTTAATATACCTCTATACTTTAACGTCAAGGAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS416 Gal-RNQ1 was a gift from Susan Lindquist (Addgene plasmid # 18684 ; http://n2t.net/addgene:18684 ; RRID:Addgene_18684) -
For your References section:
Chaperone-dependent amyloid assembly protects cells from prion toxicity. Douglas PM, Treusch S, Ren HY, Halfmann R, Duennwald ML, Lindquist S, Cyr DM. Proc Natl Acad Sci U S A. 2008 May 20. 105(20):7206-11. 10.1073/pnas.0802593105 PubMed 18480252
Map uploaded by the depositor.