Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Thy1-Brainbow-1.0 L
(Plasmid #18725)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 18725 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC18+Thy1 promoter
  • Backbone size w/o insert (bp) 9188
  • Vector type
    Mammalian Expression, Mouse Targeting, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dTomato ; EYFP ; mCerulean

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI / XhoI (destroyed during cloning)
  • 3′ cloning site SspI / XhoI (destroyed during cloning)
  • 5′ sequencing primer Thy1 F1 primer (TCTGAGTGGCAAAGGACCTTAGG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Author's Map is a representative Brainbow 1.0 construct. The actual fluorescent genes are as indicated in the Gene/insert name.

Thy1 promoter. To linearize plasmid and remove vector sequences, EcoRI + PvuI , or alternatively NotI + PvuI are used (Note that PvuI also cuts inside the pUC18 vector).

Please see attached PDF for important additional information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Thy1-Brainbow-1.0 L was a gift from Joshua Sanes (Addgene plasmid # 18725 ; http://n2t.net/addgene:18725 ; RRID:Addgene_18725)
  • For your References section:

    Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system. Livet J, Weissman TA, Kang H, Draft RW, Lu J, Bennis RA, Sanes JR, Lichtman JW. Nature. 2007 Nov 1. 450(7166):56-62. 10.1038/nature06293 PubMed 17972876