This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #18926)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 18926 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    synthetic construct
  • Insert Size (bp)
  • GenBank ID
  • Tag / Fusion Protein
    • His (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NoTI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer ggttcggcttctggcgtgtgacc
  • 3′ sequencing primer TCC TTA AAC CTG TCT TGT AA
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS-GCaMP2 was a gift from Karel Svoboda (Addgene plasmid # 18926 ; ; RRID:Addgene_18926)
  • For your References section:

    Characterization and subcellular targeting of GCaMP-type genetically-encoded calcium indicators. Mao T, O'Connor DH, Scheuss V, Nakai J, Svoboda K. PLoS ONE. 2008 . 3(3):e1796. 10.1371/journal.pone.0001796 PubMed 18350138