-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 18927 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP2
-
Speciessynthetic construct
-
Insert Size (bp)1356
-
GenBank IDDQ381402
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI/XbaI (not destroyed)
- 5′ sequencing primer Gccccattgacgcaaatg
- 3′ sequencing primer caagtaaaacctctacaaatgtgg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-GCaMP2 was a gift from Karel Svoboda (Addgene plasmid # 18927 ; http://n2t.net/addgene:18927 ; RRID:Addgene_18927) -
For your References section:
Characterization and subcellular targeting of GCaMP-type genetically-encoded calcium indicators. Mao T, O'Connor DH, Scheuss V, Nakai J, Svoboda K. PLoS ONE. 2008 . 3(3):e1796. 10.1371/journal.pone.0001796 PubMed 18350138