Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLB2 CAG P2Gm
(Plasmid #19752)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 19752 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    LB2
  • Backbone size (bp) 10552
  • Vector type
    Mammalian Expression, Mouse Targeting, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    grow in stbl3 cells at 30oC
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer GFP miR primer (GCTGGAGTTCGTGACCGCC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Lentiviral vector that constitutively expresses puromycin-resistance and GFP driven by the CAGGS promoter.

See FLIP vector protocols (PDF from this page) for more information.

Firefly hairpin sequence is -
AAGGTATATTGCTGTTGACAGTGAGCGAGCTCCCGTGAATTGGAATCCTA
GTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCCTGCCTACTGCC
TCG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLB2 CAG P2Gm was a gift from Richard Hynes (Addgene plasmid # 19752 ; http://n2t.net/addgene:19752 ; RRID:Addgene_19752)
  • For your References section:

    A system for Cre-regulated RNA interference in vivo. Stern P, Astrof S, Erkeland SJ, Schustak J, Sharp PA, Hynes RO. Proc Natl Acad Sci U S A. 2008 Sep 16. 105(37):13895-900. 10.1073/pnas.0806907105 PubMed 18779577