1
Plasmid 19752: pLB2 CAG P2Gm
  • None

  • LB2
    (Search Vector Database)

  • Mammalian Expression, Mouse Targeting, Lentiviral, RNAi

  • 10552

  • NotI

  • No

  • PmeI

  • No

  • GFP miR primer (GCTGGAGTTCGTGACCGCC) List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 30

  • grow in stbl3 cells at 30oC

  • Low Copy

  • Puromycin

  • View sequences (2)
  • View map

  • FLIP vector protocols (application/pdf)

  • Notes from Addgene (1)

  • Richard Hynes

  • MTA

Comments: 

Lentiviral vector that constitutively expresses puromycin-resistance and GFP driven by the CAGGS promoter.

See FLIP vector protocols (PDF from this page) for more information.

Firefly hairpin sequence is -
AAGGTATATTGCTGTTGACAGTGAGCGAGCTCCCGTGAATTGGAATCCTA
GTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCCTGCCTACTGCC
TCG

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A system for Cre-regulated RNA interference in vivo. Stern et al (Proc Natl Acad Sci U S A. 2008 Sep 16. 105(37):13895-900. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 19752" in your Materials and Methods section.