-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 19762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1 puro
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesmall hairpin RNA against beta-catenin
-
Alt nameCTNNB
-
SpeciesH. sapiens (human)
-
Entrez GeneCTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Reference
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
2279 refers to the shRNA
clone name from the RNAi Consortium at the Broad Institute and indicates the
location on the CTNNB1 mRNA that is targeted.
shRNA sequence for 2279 is:
CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1.sh.beta-catenin.2279 was a gift from William Hahn (Addgene plasmid # 19762 ; http://n2t.net/addgene:19762 ; RRID:Addgene_19762) -
For your References section:
CDK8 is a colorectal cancer oncogene that regulates beta-catenin activity. Firestein R, Bass AJ, Kim SY, Dunn IF, Silver SJ, Guney I, Freed E, Ligon AH, Vena N, Ogino S, Chheda MG, Tamayo P, Finn S, Shrestha Y, Boehm JS, Jain S, Bojarski E, Mermel C, Barretina J, Chan JA, Baselga J, Tabernero J, Root DE, Fuchs CS, Loda M, Shivdasani RA, Meyerson M, Hahn WC. Nature. 2008 Sep 25. 455(7212):547-51. 10.1038/nature07179 PubMed 18794900