psiCHECK c14orf28 3'UTR
(Plasmid #19856)

• Depositing Lab: Thomas Tuschl
• Publication: Landthaler et al RNA. 2008 Oct 31. ():.

Backbone

• Vector backbone: psiCHECK-2
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 6249
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: c14orf28 3'UTR
• Alt name: C14orf28
• Species: H. sapiens (human)
• Insert Size (bp): 1665
• GenBank ID: NM_001017923
• Entrez Gene: C14orf28 (a.k.a. DRIP-1, DRIP1, c14_5270)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GTACATCAAGAGCTTCGTGG
• 3′ sequencing primer: AAGACTCATTTAGATCCTCACAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.