Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

psiCHECK c14orf28 3'UTR
(Plasmid #19856)


Item Catalog # Description Quantity Price (USD)
Plasmid 19856 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6249
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    c14orf28 3'UTR
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    C14orf28 (a.k.a. DRIP1, c14_5270)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTACATCAAGAGCTTCGTGG
  • 3′ sequencing primer AAGACTCATTTAGATCCTCACAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK c14orf28 3'UTR was a gift from Thomas Tuschl (Addgene plasmid # 19856)
  • For your References section:

    Molecular characterization of human Argonaute-containing ribonucleoprotein complexes and their bound target mRNAs. Landthaler M, Gaidatzis D, Rothballer A, Chen PY, Soll SJ, Dinic L, Ojo T, Hafner M, Zavolan M, Tuschl T. RNA. 2008 Oct 31. ():. 10.1261/rna.1351608 PubMed 18978028