Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

psiCHECK RBJ 3'UTR
(Plasmid #19866)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    psiCHECK-2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6249
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    RBJ 3'UTR
  • Alt name
    DNAJC27
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3957
  • GenBank ID
    NM_016544
  • Entrez Gene
    DNAJC27 (a.k.a. RBJ, RabJS, DKFZp434N211)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTACATCAAGAGCTTCGTGG
  • 3′ sequencing primer AAGACTCATTTAGATCCTCACAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK RBJ 3'UTR was a gift from Thomas Tuschl (Addgene plasmid # 19866)
  • For your References section:

    Molecular characterization of human Argonaute-containing ribonucleoprotein complexes and their bound target mRNAs. Landthaler M, Gaidatzis D, Rothballer A, Chen PY, Soll SJ, Dinic L, Ojo T, Hafner M, Zavolan M, Tuschl T. RNA. 2008 Oct 31. ():. 10.1261/rna.1351608 PubMed 18978028