1
Plasmid 19866: psiCHECK RBJ 3'UTR
  • RBJ 3'UTR

  • DNAJC27

  • 3957

  • H. sapiens (human)

  • NM_016544

  • DNAJC27 (RBJ, RabJS, DKFZp434N211)

  • psiCHECK-2
    (Search Vector Database)

  • Promega

  • Mammalian Expression

  • 6249

  • XhoI

  • No

  • NotI

  • No

  • GTACATCAAGAGCTTCGTGG List of Sequencing Primers

  • AAGACTCATTTAGATCCTCACAC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • View map

  • Thomas Tuschl

  • UBMTA

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Molecular characterization of human Argonaute-containing ribonucleoprotein complexes and their bound target mRNAs. Landthaler et al (RNA. 2008 Oct 31. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 19866" in your Materials and Methods section.