Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGS775
(Plasmid #20169)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 20169 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT7-7
  • Backbone manufacturer
    made by S Tabor/sold by USB
  • Backbone size w/o insert (bp) 2743
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    recommended expression strain BL21 (DE3) pLysS
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RuvC
  • Species
    E. coli
  • Insert Size (bp)
    512
  • Mutation
    none
  • GenBank ID
    CAA42128

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggcctgctagaattcaaaaaggaggcgcgtgatg
  • 3′ sequencing primer ggagtggaaaagcttcagccgg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Greg Sharples

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGS775 was a gift from Stephen West (Addgene plasmid # 20169 ; http://n2t.net/addgene:20169 ; RRID:Addgene_20169)
  • For your References section:

    Cloning, overexpression, purification, and characterization of the Escherichia coli RuvC Holliday junction resolvase. Dunderdale HJ, Sharples GJ, Lloyd RG, West SC. J Biol Chem. 1994 Feb 18. 269(7):5187-94. PubMed 8106500