1
Plasmid 20326: TetO-FUW-sox2
  • sox2

  • 997

  • M. musculus (mouse)

  • Sox2 (AL606746.1, Sox-2, lcc, ysb)

  • FUW
    (Search Vector Database)

  • homemade

  • Lentiviral

  • 8376

  • EcoRI

  • No

  • EcoRI

  • No

  • AAGACCACCGCACAGCAAGC List of Sequencing Primers

  • TTCCGCCGTGGCAATAGGGA

  • Ampicillin

  • Stbl3

  • 37

  • TOP10, 37C

  • High Copy

  • Zeocin

  • View sequences (2)
  • Rudolf Jaenisch

  • MTA
    Tet Systems Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells. Brambrink et al (Cell Stem Cell. 2008 Feb 7. 2(2):151-9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 20326" in your Materials and Methods section.