1
Plasmid 20792: miR-124-5 promoter GFP
  • mir-124

  • miR124

  • 5600

  • D. rerio (zebrafish)

  • mir124-5 (dre-mir-124-5)

  • GFP

  • C terminal on backbone

  • pBSII SK+ modified to introduce GFP and more cloning sites
    (Search Vector Database)

  • Bartel Lab

  • zebrafish expression

  • SmaI

  • Yes

  • SalI

  • Unknown

  • TGCTTTGAGGCACGGTTATGGTCCC List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (2)
  • View map

  • David Bartel

  • MTA

Comments: 

5′-RACE (GenRacer kit, Invitrogen) identified a transcriptional start of the mir-124-5 primary transcript, which is located 1.1 kb from the mir-124-5 hairpin. A 5.6-kb fragment upstream of the mir-124-5 transcriptional start was amplified from genomic DNA using primers 1 and 2 (5'-TGCTTTGAGGCACGGTTATGGTCCC-3' and 5'-CTCGGGCAGCGGCTTTTTGGTCCTG-3'). The promoter fragment was fused to a GFP reporter gene. The miRNA promoter fusion was flanked by I-SceI meganuclease recognition sites to increase the efficiency of transgenensis.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Coherent but overlapping expression of microRNAs and their targets during vertebrate development. Shkumatava et al (Genes Dev. 2009 Feb 15. 23(4):466-81. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 20792" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only