MD-2
(Plasmid #20864)

• Depositing Lab: Jie-Oh Lee
• Publication: Park et al Nature. 2009 Mar 1. ():.

Backbone

• Vector backbone: pAcGP67A
• Backbone manufacturer: BD biosciences
• Backbone size w/o insert (bp): 9761
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Myeloid differentiation factor 2
• Alt name: MD-2
• Species: H. sapiens (human)
• Insert Size (bp): 861
• Mutation: contains amino acids 19–160
• GenBank ID: NP_056179.3
• Entrez Gene: LY96 (a.k.a. ESOP-1, MD-2, MD2, ly-96)
• Tag / Fusion Protein:
  • protein A tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ggcttcaataaggaacacacaagcaag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry