1
Plasmid 21050: RCAS(B)-Rheb-Q64L
  • Ras-homolog enriched in brain

  • Rheb

  • 685

  • H. sapiens (human)

  • AF493921

  • RHEB (RHEB2)

  • FLAG

  • N terminal on insert

  • glutamine 64 to leucine

  • pBR322
    (Search Vector Database)

  • Bacterial Expression, Retroviral

  • 11689

  • SfiI(A)

  • No

  • SfiI(B)

  • No

  • AGCTCCGCGGGCCACCATGGACTACAAGGATGACGATGACAAGGCGGCCGCGCCGCAGTCCAAG List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Peter Vogt

  • MTA

Comments: 

The creation of RCAS(B)-SfiI and the adapter plasmid pBSFI was described in Aoki et al., PNAS. 1998 Dec 8;95(25):14950-5. The SacII/XbaI fragment was cloned into pBSFI and the Sfi fragment was further cloned into RCAS(B)-SfiI.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Constitutively active Rheb induces oncogenic transformation. Jiang et al (Oncogene. 2008 Sep 25. 27(43):5729-40. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21050" in your Materials and Methods section.