pREP3-TEV-NLS
(Plasmid #21146)

• Depositing Lab: Stephen Kearsey
• Publication: Yang et al BMC Mol Biol. 2005 . 6():13.

Backbone

• Vector backbone: pREP3X
• Backbone size w/o insert (bp): 8754
• Vector type: Yeast Expression ; S. pombe
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TEV protease
• Species: tobacco etch virus
• Insert Size (bp): 1176
• GenBank ID: AAA47909
• Entrez Gene: TEVgp1 (a.k.a. TEVgp1)
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • myc (N terminal on insert)
  • 2xNLS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SmaI (not destroyed)
• 5′ sequencing primer: TCACTTTCTGACTTATAGTCGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: F Uhlmann, K Nasmyth

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

plasmid modified from one used to express TEV protease in S. cerevisiae

Some mismatches between Addgene QC sequence and author-provided sequence, but author has determined that TEV expression would not be affected.