-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBluescriptKSII
-
Backbone manufacturerstratagene
- Backbone size w/o insert (bp) 2381
-
Vector typeMammalian Expression ; human targeting
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Growth instructionsXL1blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehOCT4-GFP
-
Alt namehCol1a1 targeting arms
-
SpeciesH. sapiens (human)
-
Insert Size (bp)120006
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGATAAGCTTGGTACCGAGC
- 3′ sequencing primer CCAACACACTATTGCAATGAAA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
human oct4-GFP was a gift from Rudolf Jaenisch (Addgene plasmid # 21153 ; http://n2t.net/addgene:21153 ; RRID:Addgene_21153) -
For your References section:
Nanoparticles for gene transfer to human embryonic stem cell colonies. Green JJ, Zhou BY, Mitalipova MM, Beard C, Langer R, Jaenisch R, Anderson DG. Nano Lett. 2008 Oct . 8(10):3126-30. 10.1021/nl8012665 PubMed 18754690