1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 21153: human oct4-GFP
  • hOCT4-GFP

  • hCol1a1 targeting arms

  • 120006

  • H. sapiens (human)

  • BluescriptKSII
    (Search Vector Database)

  • stratagene

  • Mammalian Expression

  • human targeting

  • 2381

  • XhoI

  • No

  • XbaI

  • No

  • CGATAAGCTTGGTACCGAGC List of Sequencing Primers

  • CCAACACACTATTGCAATGAAA

  • Ampicillin

  • XL1 Blue

  • 37

  • XL1blue

  • Unknown

  • Puromycin

  • View sequences (2)
  • Rudolf Jaenisch

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Nanoparticles for gene transfer to human embryonic stem cell colonies. Green et al (Nano Lett. 2008 Oct . 8(10):3126-30. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21153" in your Materials and Methods section.