LZRS-RasG12V
(Plasmid
#21203)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21203 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLZRS-RfA
- Backbone size w/o insert (bp) 11100
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsSTBL2
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRas
-
Alt nameH-ras
-
SpeciesH. sapiens (human)
-
Insert Size (bp)566
-
MutationG12V
-
Entrez GeneHRAS (a.k.a. C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-RASIDX, HAMSV, HRAS1, RASH1, p21ras)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGGATACACGCCGCCCACGTG
- 3′ sequencing primer ATCGTCGACCACTGTGCTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LZRS-RasG12V was a gift from Paul Khavari (Addgene plasmid # 21203 ; http://n2t.net/addgene:21203 ; RRID:Addgene_21203) -
For your References section:
Epidermal Ras blockade demonstrates spatially localized Ras promotion of proliferation and inhibition of differentiation. Dajee M, Tarutani M, Deng H, Cai T, Khavari PA. Oncogene. 2002 Feb 28;21(10):1527-38 10.1038/sj.onc.1205287 PubMed 11896581
Map uploaded by the depositor.