1
Plasmid 21222: T/Brachyury-eGFP Rex Neo
  • Brachyury promoter

  • 644

  • M. musculus (mouse)

  • eGFP

  • C terminal on backbone

  • SIN18
    (Search Vector Database)

  • Lentiviral

  • 7838

  • claI

  • No

  • ageI

  • No

  • CTTGATGCCGTTCTTCTGCTT - 3' sequencing only List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • Unknown

  • Neomycin resistanct marker driven by Rex-1 promoter

  • View sequences (2)
  • Notes from Addgene (1)

  • Mark Mercola

  • MTA

Comments: 

There are several mismatches between depositor's and Addgene sequence. These mutations do not affect eGFP expression.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Lentiviral vectors and protocols for creation of stable hESC lines for fluorescent tracking and drug resistance selection of cardiomyocytes. Kita-Matsuo et al (PLoS ONE. 2009 . 4(4):e5046. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21222" in your Materials and Methods section.