Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

GST-GW1D1(aa254-751)
(Plasmid #21523)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21523 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCG-GST
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TNRC6A
  • Alt name
    GW182
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • Mutation
    contain aa254-751
  • GenBank ID
    NP_055309
  • Entrez Gene
    TNRC6A (a.k.a. CAGH26, FAME6, GW1, GW182, TNRC6)
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bam HI (not destroyed)
  • 3′ cloning site Stu I (destroyed during cloning)
  • 5′ sequencing primer CAGCAAGTATATAGCATGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

In our JCS paper (Li et al. J Cell Sci. 2008 Dec 15;121(Pt 24):4134-44), a new isoform of GW182 was identified with an extra N-terminal 253-amino-acid. That is why the name of these two clones changed from the original GW182D1a (aa1-250) and GW182D1(aa1-498) to GW1D1a(aa254-503) and GW1D1(aa254-751), respectively.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GST-GW1D1(aa254-751) was a gift from Edward Chan (Addgene plasmid # 21523 ; http://n2t.net/addgene:21523 ; RRID:Addgene_21523)
  • For your References section:

    The C-terminal half of human Ago2 binds to multiple GW-rich regions of GW182 and requires GW182 to mediate silencing. Lian SL, Li S, Abadal GX, Pauley BA, Fritzler MJ, Chan EK. RNA. 2009 May . 15(5):804-13. 10.1261/rna.1229409 PubMed 19324964