Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pDsRed2-Keap1
(Plasmid #21551)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21551 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDsRed2-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    kelch-like ECH-associated protein 1
  • Alt name
    KEAP1
  • Alt name
    INrf2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1879
  • GenBank ID
    Q14145
  • Entrez Gene
    KEAP1 (a.k.a. INrf2, KLHL19)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer 5'd[GTACTGGAACTGGGGGGACAG]
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDsRed2-Keap1 was a gift from Yue Xiong (Addgene plasmid # 21551 ; http://n2t.net/addgene:21551 ; RRID:Addgene_21551)
  • For your References section:

    BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Furukawa M, Xiong Y. Mol Cell Biol. 2005 Jan . 25(1):162-71. 10.1128/MCB.25.1.162-171.2005 PubMed 15601839