1
Plasmid 21603: pIE2-AD
  • NF-kappa-B p65 subunit

  • p65

  • 681

  • M. musculus (mouse)

  • NP_033071

  • Rela (p65)

  • NLS

  • N terminal on backbone

  • Flag

  • N terminal on backbone

  • Gateway destination cassette

  • C terminal on backbone

  • pIZT
    (Search Vector Database)

  • Invitrogen

  • Insect Expression ; Gateway Destination Vector

  • 4635

  • Gateway Cloning

  • TTATCGCGCCTATAAATACAGCCCGCAAC List of Sequencing Primers

  • CACGCGCTTGAAAGGAGTGTGTAAATGGAC

  • Tetracycline and Chloramphenicol

  • ccdB Survival

  • 37

  • DB3.1 (Invitrogen) 37°C

  • High Copy

  • View sequences (4)
  • Takahiro Kusakabe

  • UBMTA

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Analysis of protein interactions with two-hybrid system in cultured insect cells. Mon et al (Anal Biochem. 2009 May 26. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21603" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only