pIE2-AD
(Plasmid #21603)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pIZT
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4635
  • Vector type
    Insect Expression ; Gateway Destination Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline and Chloramphenicol
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    DB3.1 (Invitrogen) 37°C
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    NF-kappa-B p65 subunit
  • Alt name
    p65
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    681
  • GenBank ID
    NP_033071
  • Entrez Gene
    Rela (a.k.a. p65)
  • Tags / Fusion Proteins
    • NLS (N terminal on backbone)
    • Flag (N terminal on backbone)
    • Gateway destination cassette (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTATCGCGCCTATAAATACAGCCCGCAAC
  • 3′ sequencing primer CACGCGCTTGAAAGGAGTGTGTAAATGGAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIE2-AD was a gift from Takahiro Kusakabe (Addgene plasmid # 21603)
  • For your References section:

    Analysis of protein interactions with two-hybrid system in cultured insect cells. Mon H, Sugahara R, Hong SM, Lee JM, Kamachi Y, Kawaguchi Y, Kusakabe T. Anal Biochem. 2009 May 26. ():. 10.1016/j.ab.2009.05.033 PubMed 19481053