Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLLNeo-Oct3
(Plasmid #21618)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21618 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLLU2G
  • Backbone size w/o insert (bp) 7861
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Oct3 shRNA
  • Alt name
    Oct4, Pou5f1
  • Insert Size (bp)
    54

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer BGH-rev
  • 3′ sequencing primer mPGK-F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Oct3 shRNA sequence is - 5'-TTGTTTGAACCGTGTGAGGTGGAACTTCAAGAGAGTTCCACCTCACACGGTTCT

This is a 3rd generation lentiviral plasmid.

This plasmid worked for mouse and rat Oct4 knockdown, but it was not tested in human cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLLNeo-Oct3 was a gift from David Garbers (Addgene plasmid # 21618 ; http://n2t.net/addgene:21618 ; RRID:Addgene_21618)
  • For your References section:

    Spermatogonial stem cell self-renewal requires OCT4, a factor downregulated during retinoic acid-induced differentiation. Dann CT, Alvarado AL, Molyneux LA, Denard BS, Garbers DL, Porteus MH. Stem Cells. 2008 Nov . 26(11):2928-37. 10.1634/stemcells.2008-0134 PubMed 18719224