Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pE2-Orange-N1
(Plasmid #21719)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pDsRed-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Sequence Information

Gene/Insert

  • Gene/Insert name
    E2-Orange
  • Alt name
    DsRed
  • Species
    Discosoma
  • Insert Size (bp)
    678
  • GenBank ID
    FJ498891

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer cggacgcagatctcgagctcaagc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pE2-Orange-N1 was a gift from Benjamin Glick (Addgene plasmid # 21719)
  • For your References section:

    Noncytotoxic orange and red/green derivatives of DsRed-Express2 for whole-cell labeling. Strack RL, Bhattacharyya D, Glick BS, Keenan RJ. BMC Biotechnol. 2009 . 9():32. 10.1186/1472-6750-9-32 PubMed 19344508