1
Plasmid 21720: pE2-Red/Green-N1
  • E2-Red/Green

  • DsRed

  • 678

  • Discosoma

  • FJ498892

  • pDsRed-N1
    (Search Vector Database)

  • Clontech

  • Mammalian Expression

  • 4000

  • BamHI

  • No

  • NotI

  • No

  • cggactcagatctcgagctcaagc List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • Unknown

  • Neomycin

  • View sequences (2)
  • Benjamin Glick

  • MTA
    Clontech Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Noncytotoxic orange and red/green derivatives of DsRed-Express2 for whole-cell labeling. Strack et al (BMC Biotechnol. 2009 . 9():32. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21720" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only