pSiP4
(Plasmid
#21960)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 21960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepsiCHECK2
- Backbone size w/o insert (bp) 6273
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePten
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)850
-
Entrez GenePten (a.k.a. 2310035O07Rik, A130070J02Rik, AI463227, B430203M17Rik, MMAC, MMAC1, PTENbeta, TEP, TEP1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTCCGCAACTACAACGCCTACCTT (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSiP4 was a gift from Klaus Rajewsky (Addgene plasmid # 21960 ; http://n2t.net/addgene:21960 ; RRID:Addgene_21960) -
For your References section:
Lymphoproliferative disease and autoimmunity in mice with increased miR-17-92 expression in lymphocytes. Xiao C, Srinivasan L, Calado DP, Patterson HC, Zhang B, Wang J, Henderson JM, Kutok JL, Rajewsky K. Nat Immunol. 2008 Apr . 9(4):405-14. 10.1038/ni1575 PubMed 18327259