1
Plasmid 22498: U6+27-cxcr4
  • U6 CXCR4 control

  • 100

  • U6+27
    (Search Vector Database)

  • Mammalian Expression

  • 5000

  • XhoI

  • No

  • ApaI

  • No

  • n/a List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Phil Sharp

  • MTA

Comments: 

CXCR4 bulged Renilla luciferase reporter, 7 sites or 1 site; CMV sponge, 7 sites; U6 sponge, 4 sites
AAGUUUUCAGAAAGCUAACA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert et al (Nat Methods. 2007 Sep . 4(9):721-6. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22498" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only