1
Plasmid 22509: pSicoR (GFP) cRel shRNA1
  • cRel shRNA1

  • cRel

  • M. musculus (mouse)

  • Rel (c-Rel)

  • pSicoR GFP
    (Search Vector Database)

  • Available at Addgene (#11579)

  • Mammalian Expression, Lentiviral, RNAi, Cre/Lox

  • 7500

  • mU6-F List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (3)
  • Tyler Jacks

  • MTA

Comments: 

Mouse cRel shRNA1 in pSicoReverse (GFP)
forward oligo:
TGGAATGCGGTTTAGATACATTCAAGAGATGTATCTAAACCGCATTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGAATGCGGTTTAGATACATCTCTTGAATGTATCTAAACCGCATTCCA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22509" in your Materials and Methods section.