1
Plasmid 22551: Flag-HA-OTUB1
  • OTUB1

  • OTU domain, ubiquitin aldehyde binding 1

  • FLJ20113, FLJ40710, HSPC263, MGC111158, MGC4584, OTB1, OTU1

  • H. sapiens (human)

  • BC007519.2

  • OTUB1 (OTB1, OTU1, HSPC263, MGC4584, FLJ20113, FLJ40710, MGC111158)

  • HA

  • N terminal on backbone

  • FLAG

  • N terminal on backbone

  • None

  • MSCV-N-Flag-HA-IRES-PURO
    (Search Vector Database)

  • Harper_Lab

  • Mammalian Expression, Retroviral

  • 6521

  • GATEWAY_LR

  • Unknown

  • GATEWAY_LR

  • Unknown

  • CAGCCCTCACTCCTTCTCTAGG List of Sequencing Primers

  • CAAGCGGCTTCGGCCAGTAAC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • Marc_Vidal_Orfeome_collection

  • View sequences (1)
  • Wade Harper

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Defining the human deubiquitinating enzyme interaction landscape. Sowa et al (Cell. 2009 Jul 23. 138(2):389-403. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22551" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only