Plasmid 22585: Flag-HA-USP48
  • USP48

  • ubiquitin specific peptidase 48

  • DKFZp762M1713, MGC132556, MGC14879, RAP1GA1, USP31

  • H. sapiens (human)

  • BC104896

  • USP48 (USP31, RAP1GA1, MGC14879, MGC132556, DKFZp762M1713)

  • HA

  • N terminal on backbone

  • FLAG

  • N terminal on backbone

  • None

    (Search Vector Database)

  • Harper_Lab

  • Mammalian Expression, Retroviral

  • 6521

  • Gateway Cloning


  • Unknown


  • Unknown

  • CAGCCCTCACTCCTTCTCTAGG List of Sequencing Primers


  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • MGC/Open

  • View sequences (1)
  • Wade Harper


Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Defining the human deubiquitinating enzyme interaction landscape. Sowa et al (Cell. 2009 Jul 23. 138(2):389-403. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22585" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only