Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #22585)

Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6521
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.


  • Gene/Insert name
  • Alt name
    ubiquitin specific peptidase 48
  • Alt name
    DKFZp762M1713, MGC132556, MGC14879, RAP1GA1, USP31
  • Species
    H. sapiens (human)
  • Mutation
  • GenBank ID
  • Entrez Gene
    USP48 (a.k.a. RAP1GA1, USP31)
  • Tags / Fusion Proteins
    • HA (N terminal on backbone)
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site GATEWAY_LR (unknown if destroyed)
  • 3′ cloning site GATEWAY_LR (unknown if destroyed)
  • 5′ sequencing primer CAGCCCTCACTCCTTCTCTAGG
  • 3′ sequencing primer CAAGCGGCTTCGGCCAGTAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-HA-USP48 was a gift from Wade Harper (Addgene plasmid # 22585)
  • For your References section:

    Defining the human deubiquitinating enzyme interaction landscape. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Cell. 2009 Jul 23. 138(2):389-403. 10.1016/j.cell.2009.04.042 PubMed 19615732