Plasmid 22586: Flag-HA-USP49
  • USP49

  • ubiquitin specific peptidase 49

  • MGC20741

  • H. sapiens (human)

  • BC014176.2

  • USP49 (RP11-298J23.4)

  • HA

  • N terminal on backbone

  • FLAG

  • N terminal on backbone

  • None

    (Search Vector Database)

  • Harper_Lab

  • Mammalian Expression, Retroviral

  • 6521

  • Gateway Cloning


  • Unknown


  • Unknown

  • CAGCCCTCACTCCTTCTCTAGG List of Sequencing Primers


  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • Marc_Vidal_Orfeome_collection

  • View sequences (1)
  • Wade Harper


Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Defining the human deubiquitinating enzyme interaction landscape. Sowa et al (Cell. 2009 Jul 23. 138(2):389-403. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22586" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only