1
Plasmid 22744: pBp-Control Sponge (CXCR4 sponge)
  • CXCR4 control sponge

  • stable control sponge

  • 2000

  • pBABE-puro
    (Search Vector Database)

  • Weinberg lab (Addgene#:1764)

  • Mammalian Expression, Retroviral

  • 5169

  • Non-targeting complementary sites (7x in tandem) to serve as a negative control for microRNA sponge-mediated inhibition of specific microRNA function; suitable for stable expression. Note that EGFP is also cloned into this backbone, upstream of the sponge.

  • BamHI

  • Unknown

  • ApaI

  • Unknown

  • pBabe-5 List of Sequencing Primers

  • pBabe-3

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • View sequences (2)
  • Bob Weinberg

  • MTA

Comments: 

Subclond from CMV-CXCR4 control sponge, as described in Ebert et al. (Nature Methods, 2007)

Sequence of sponge: AAGUUUUCAGAAAGCUAACA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan et al (Cell. 2009 Jun 12. 137(6):1032-46. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22744" in your Materials and Methods section.