Non-targeting complementary sites (7x in tandem) to serve as a negative control for microRNA sponge-mediated inhibition of specific microRNA function; suitable for stable expression.
Note that EGFP is also cloned into this backbone, upstream of the sponge.
Please acknowledge the principal investigator and cite this article if you use
this plasmid in a publication. Also, please include the text "Addgene plasmid
22744" in your Materials and Methods section.
Subclond from CMV-CXCR4 control sponge, as described in Ebert et al. (Nature Methods, 2007)
Sequence of sponge: AAGUUUUCAGAAAGCUAACA