1
Plasmid 23118: pcDNA5/FRT/TO-Flag-Tipin-L195A
  • Tipin

  • Timeless-interacting protein

  • 903

  • H. sapiens (human)

  • TIPIN (FLJ20516)

  • Flag

  • N terminal on insert

  • Changed Leucine 195 to Alanine

  • pcDNA5/FRT/TO
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 5137

  • BamHI

  • No

  • XhoI

  • No

  • CMV: CGCAAATGGGCGGTAGGCGTG List of Sequencing Primers

  • BGH

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Hygromycin

  • View sequences (2)
  • Aziz Sancar

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Tipin-RPA interaction mediates Chk1 phosphorylation by ATR in response to genotoxic stress. Kemp et al (J Biol Chem. 2010 Mar 15. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 23118" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with