Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #23118)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 23118 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5137
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Timeless-interacting protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Changed Leucine 195 to Alanine
  • Entrez Gene
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer BGH
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT/TO-Flag-Tipin-L195A was a gift from Aziz Sancar (Addgene plasmid # 23118)
  • For your References section:

    Tipin-RPA interaction mediates Chk1 phosphorylation by ATR in response to genotoxic stress. Kemp MG, Akan Z, Yilmaz S, Grillo M, Smith-Roe SL, Kang TH, Cordeiro-Stone M, Kaufmann WK, Abraham RT, Sancar A, Unsal-Kacmaz K. J Biol Chem. 2010 Mar 15. ():. 10.1074/jbc.M110.110304 PubMed 20233725