Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBY2982
(Plasmid #23220)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 23220 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    EGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3992
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BirA-mCherry
  • Species
    Top10 E.coli, Discosoma sp.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBY2982 was a gift from Ralf Baumeister (Addgene plasmid # 23220 ; http://n2t.net/addgene:23220 ; RRID:Addgene_23220)
  • For your References section:

    SnAvi - a new tandem tag for high-affinity protein-complex purification. Schaffer U, Schlosser A, Muller KM, Schafer A, Katava N, Baumeister R, Schulze E. Nucleic Acids Res. 2010 Jan 4. ():. 10.1093/nar/gkp1178 PubMed 20047968