1
Plasmid 24562: pRRL CAG NFlag BAF170 ires GFP
  • BAF155

  • smarcc2

  • 3600

  • M. musculus (mouse)

  • NM_001114097

  • Smarcc2 (5930405J04Rik)

  • Flag

  • N terminal on insert

  • pRRL-sin18PPT CAG-ires-GFP
    (Search Vector Database)

  • Lentiviral

  • 9200

  • Age1

  • No

  • Pst1

  • No

  • gctaaccatgttcatgccttc List of Sequencing Primers

  • Ampicillin

  • XL10 Gold

  • 37

  • XL-10 Gold, Stratagene

  • Low Copy

  • View sequences (2)
  • Jerry Crabtree

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: An embryonic stem cell chromatin remodeling complex, esBAF, is essential for embryonic stem cell self-renewal and pluripotency. Ho et al (Proc Natl Acad Sci U S A. 2009 Mar 31. 106(13):5181-6. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24562" in your Materials and Methods section.