Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRRL CAG NFlag BAF170 ires GFP
(Plasmid #24562)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 24562 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pRRL-sin18PPT CAG-ires-GFP
  • Backbone size w/o insert (bp) 9200
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL10 Gold
  • Growth instructions
    XL-10 Gold, Stratagene
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Smarcc2 (a.k.a. 5930405J04Rik)
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (not destroyed)
  • 3′ cloning site Pst1 (not destroyed)
  • 5′ sequencing primer gctaaccatgttcatgccttc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL CAG NFlag BAF170 ires GFP was a gift from Jerry Crabtree (Addgene plasmid # 24562)
  • For your References section:

    An embryonic stem cell chromatin remodeling complex, esBAF, is essential for embryonic stem cell self-renewal and pluripotency. Ho L, Ronan JL, Wu J, Staahl BT, Chen L, Kuo A, Lessard J, Nesvizhskii AI, Ranish J, Crabtree GR. Proc Natl Acad Sci U S A. 2009 Mar 31. 106(13):5181-6. 10.1073/pnas.0812889106 PubMed 19279220